Format Conversion
-Combine FASTA
-EMBL to FASTA
-EMBL Feature Extractor
-EMBL Trans Extractor
-Filter DNA
-Filter Protein
-GenBank to FASTA
-GenBank Feature Extractor
-GenBank Trans Extractor
-One to Three
-Range Extractor DNA
-Range Extractor Protein
-Reverse Complement
-Split Codons
-Split FASTA
-Three to One
-Window Extractor DNA
-Window Extractor Protein
Sequence Analysis
-Codon Plot
-Codon Usage
-CpG Islands
-DNA Molecular Weight
-DNA Pattern Find
-DNA Stats
-Fuzzy Search DNA
-Fuzzy Search Protein
-Ident and Sim
-Multi Rev Trans
-Mutate for Digest
-ORF Finder
-Pairwise Align Codons
-Pairwise Align DNA
-Pairwise Align Protein
-PCR Primer Stats
-PCR Products
-Protein GRAVY
-Protein Isoelectric Point
-Protein Molecular Weight
-Protein Pattern Find
-Protein Stats
-Restriction Digest
-Restriction Summary
-Reverse Translate
-Translate
Sequence Figures
-Color Align Conservation
-Color Align Properties
-Group DNA
-Group Protein
-Primer Map
-Restriction Map
-Translation Map
Random Sequences
-Mutate DNA
-Mutate Protein
-Random Coding DNA
-Random DNA Sequence
-Random DNA Regions
-Random Protein Sequence
-Random Protein Regions
-Sample DNA
-Sample Protein
-Shuffle DNA
-Shuffle Protein
Miscellaneous
-IUPAC codes
-Genetic codes
-Browser compatibility
-Mirror this site
-Use this site off-line
-About this site
-Acknowledgments
-Reference
The Sequence Manipulation Suite Copyright © 2000, 2004 Paul Stothard. Send questions and comments to stothard@ualberta.ca
home
Sequence Manipulation Suite:
Split FASTA
Split FASTA divides FASTA sequence records into smaller FASTA sequences of the size you specify. An optional overlap value can be used to create sequences that overlap.
Paste the FASTA sequences into the text area below. Input limit is 500000 characters.
>random_sequence_1000_bases gtttcaaactgtccaggtctaatggtgtgaagcgatactgtttgatgcctggttggtgca actggcggcaaaacggcttaaagctccagatgccacattagtgaggacctggtgtattac gttggattaccctgtgacagctcaggcacacaccaggattaggaaattagcatcgtaaga ctagtccgtacaaacaaaaacaaaaaatagaagtttcaagtggttcccgttgttggagcg cgtaagggatacgtaataataggtcaggtcagaaagaagcggcttggagccccatttata tctttaacatcgggagaatcatccgtcgaccttgtggcacggtttgccggcgcgaatagg gtggacgtagatattagacggagacggttgaagcttacctcgtagctgggaactctatgg agtggctaccctatggacttcctccggcagcgcaggtttcaaaatgagcaatcagcaatt cctaggatgaagccgcgagctaaaaacttcagcgcttccgcatgcgttactgtcctggag agttttaatcgggtgtctgtcacacacctcggatctcgcccactgcgtgagccttagata cgcagtgatgcaatggatgtaggtctctagcgaagccaagtctagtcgcgcctccgcgcg caagtctgcgataatgggcaagtgcctgcagtctaagtataactcgtcgccagatgcggc ataggattatgagcgtttcccctgcgcgttatggtacccggaccgggcccgcgacacacg gtgcacaggtagagctagttaggcgtaacgacgccagaattatgtttattatttacctgt gacgcaagctaacagtagtgccccggggtgctagtaagtaagcagagaactgggatgtag ccgtcaaaggtcttttgccgagatgactactacaaccgtatagacaaagcgtgcacatta catggggagtacctacttccagaacctgtgtcttcctagt
The new sequences should be
bases long.
The new sequences should overlap by
bases.
Please check the
browser compatibility
page before using this program.
*This page requires JavaScript. See
browser compatibility.
*You can
mirror this page
or
use it off-line
.
new window
|
home
|
citation
Fri May 4 16:40:40 2012